Understand how PCR copies a target and check a primer pair before you set up a reaction.
Why it matters
The polymerase chain reaction (PCR) makes millions of copies of one short stretch of DNA in about an hour. It is behind genotyping, cloning, pathogen detection, forensic profiling and most sequencing library preparation. Biological technicians set up PCRs constantly, and most failures trace back to two things: badly designed primers and careless reaction setup.
The core idea
PCR repeats three temperature steps, usually 25 to 35 times, in a thermal cycler:
- Denature at about 94 to 98 C: the two DNA strands separate.
- Anneal at about 50 to 65 C: two short primers bind to their complementary sites on opposite strands, flanking the target.
- Extend at about 72 C: a heat-stable DNA polymerase (such as Taq) adds nucleotides to the 3' end of each primer.
Each cycle roughly doubles the target, so after n perfect cycles one copy becomes 2^n copies. In practice efficiency is below 100 percent and the reaction plateaus as reagents run out, which is why plain PCR is good for "is it there, and how big is it?" but not for measuring how much was there to begin with. That is what qPCR (next lesson) is for.
What goes in the tube
A typical 25 uL reaction contains:
| Component | Role |
|---|---|
| Template DNA | The DNA containing your target (often 1 to 100 ng genomic DNA) |
| Forward and reverse primers | Define the start and end of the product (often 0.1 to 0.5 uM each) |
| dNTPs | The A, C, G, T building blocks |
| Polymerase buffer with Mg2+ | Magnesium is a required cofactor; its concentration affects specificity |
| DNA polymerase | Copies the DNA |
| Nuclease-free water | Brings the volume up |
Labs usually make a master mix of everything except template, split it into tubes, then add template last. Always include a no-template control (NTC), with water instead of template, to catch contamination, and a positive control known to work.
Designing primers
Primers are short single-stranded DNA pieces. Common rules of thumb:
- Length 18 to 25 nucleotides.
- GC content 40 to 60 percent.
- Melting temperature (Tm) roughly 52 to 65 C, with the two primers within about 5 C of each other.
- A G or C in the last one or two bases at the 3' end (a "GC clamp") helps the polymerase start, but avoid more than three G or C in the last five bases.
- Avoid runs of four or more of one base, and avoid primers that pair with themselves or each other (hairpins and primer dimers).
- The reverse primer is written 5' to 3' and matches the reverse complement of the top strand.
A quick Tm estimate for short primers is the Wallace rule:
Tm = 2 x (number of A + T) + 4 x (number of G + C)
Worked example. Primer AGCTGACCTGAAGGCTCTTG has 20 bases: A 4, T 5, G 6, C 5. A + T = 9 and G + C = 11, so Tm = 2 x 9 + 4 x 11 = 62 C. GC content is 11 / 20 = 55 percent. Both are in range.
The Wallace rule is only a rough guide (it ignores salt and the order of bases). Real design uses nearest-neighbour calculators such as Primer-BLAST from NCBI (https://www.ncbi.nlm.nih.gov/tools/primer-blast/, checked on 2026-10-23), which also checks that the primers match only your intended target. A common starting annealing temperature is about 3 to 5 C below the lower primer Tm, refined with a gradient PCR.
Reading the result
PCR products are usually checked on an agarose gel (module 2). You expect one sharp band at the predicted size, nothing in the NTC, and a band in the positive control. Extra bands suggest non-specific priming (try a higher annealing temperature); a smear suggests too much template or too many cycles; a band in the NTC means contamination, so the whole run is suspect.
Avoiding contamination
Because PCR is so sensitive, one stray product molecule can give a false positive. Good labs separate pre-PCR (reagent and setup) and post-PCR (gel) areas, use filter tips, never bring opened products back to the setup area, and clean benches before setup. Clinical molecular labs follow these rules strictly and are inspected on them.
Common mistakes
- Forgetting the NTC, so contamination goes unnoticed.
- Writing the reverse primer as the top-strand sequence instead of its reverse complement.
- Primer Tm values 10 C apart, so one primer barely binds at the chosen temperature.
- Adding template to the master mix before splitting it.
- Opening post-PCR tubes in the setup area.
Quick recap
- Denature, anneal, extend; each cycle roughly doubles the target.
- Master mix, template last, NTC and positive control every time.
- Primers: 18 to 25 nt, 40 to 60 percent GC, Tm within 5 C, no runs or dimers.
- Wallace rule Tm = 2(A+T) + 4(G+C) is a quick estimate; use Primer-BLAST for real design.
Try it
Open the Do tab. A Python primer checker is ready except for the Tm formula, which you write.